View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8084_low_24 (Length: 226)
Name: NF8084_low_24
Description: NF8084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8084_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 13633382 - 13633580
Alignment:
| Q |
9 |
cagaacctgtggcaggaagcattgtaggcatctgtagcagcaacatctgttgaggcgaaggacaagtatggtcgataaacaaagttgcgacttctggatt |
108 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
13633382 |
cagaatctgtagcaggaagcattgtaggcatctgtagcagcaacatctgttgaggcgaaggacaagtatggtcgatcaacaatgttgtgacttctggatt |
13633481 |
T |
 |
| Q |
109 |
ttcctttggatactggcataggtgatgctgccaattcaaactggatagaaaacatttacaaaagttagcctaagataaacatgaccaataaagctacaa |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13633482 |
ttcctttggatacttgcataggtgatgctgccaattcaaactggatagaaaacatttacaaaagttagcctaagataaacatgaccaataaagctacaa |
13633580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 136 - 207
Target Start/End: Complemental strand, 27533667 - 27533597
Alignment:
| Q |
136 |
ctgccaattcaaactggatagaaaacatttacaaaagttagcctaagataaacatgaccaataaagctacaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
27533667 |
ctgccaattcaaactggatagaaaacatttacaaaagttagcc-aagataaacatgattaatgaagctacaa |
27533597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 123
Target Start/End: Complemental strand, 27533732 - 27533665
Alignment:
| Q |
56 |
tgttgaggcgaaggacaagtatggtcgataaacaaagttgcgacttctggattttcctttggatactg |
123 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |||||||||| | ||| |||||| |||||||||||| |
|
|
| T |
27533732 |
tgttgaggcaaaggagaagtatggtcgatcaacaaagttgtgctttcgggatttggctttggatactg |
27533665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 171
Target Start/End: Original strand, 13688851 - 13688891
Alignment:
| Q |
131 |
tgatgctgccaattcaaactggatagaaaacatttacaaaa |
171 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||| |||||| |
|
|
| T |
13688851 |
tgatactgccaattcaaactggatagagaacattgacaaaa |
13688891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University