View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_40 (Length: 296)
Name: NF8085_high_40
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 26 - 200
Target Start/End: Complemental strand, 31592324 - 31592154
Alignment:
| Q |
26 |
aaatagaagtactcctaaacatcttaaagatagagtgcttcattgatga---aaatcataagaaaatcctttagtttaatttggatcaacaaacaactat |
122 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||||||| | |||||| |||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
31592324 |
aaatagaagtactcctaagcatcttgaagatagagtgtttcattgataataaaaatcagaagaaaatcctttagttt----tggatcaacaaacaactct |
31592229 |
T |
 |
| Q |
123 |
tgacttttcaaaccaagattataaaaccttgtaaacactcgttagtgtgttttcaaacgttgacaaccctctaaagat |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| || ||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
31592228 |
tgacttttcaaaccaggattataaaaccttgtagacac---ttggtgtgttttcaaatgttgacgaccttctaaagat |
31592154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 225 - 280
Target Start/End: Complemental strand, 31592156 - 31592101
Alignment:
| Q |
225 |
gattctgacattcaatcaaatatctagatgcttgtcttcaactccaatgaaaaata |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31592156 |
gattctgacattcaatcaaatatctagatgcttgtcttcaactccaatgaaaaata |
31592101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University