View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_45 (Length: 273)
Name: NF8085_high_45
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 36 - 257
Target Start/End: Original strand, 2268353 - 2268574
Alignment:
| Q |
36 |
aatatcgtgtgtagttgcatatgtagtctttttgttgttatggttatgtttcagcaatctcttgttataagtgtctttcatactaagatactaatccttg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2268353 |
aatatcgtgtgtagttgcatatgtagtctttttgttgttatggttatgtttcaacaatctcttgttataagtgtctttcatactaagatactaatccttg |
2268452 |
T |
 |
| Q |
136 |
ggttcattctatttaaggataacttagtctgttgccactttcgttattagttgatttatcagttaatttatgtctaccacttgattttttcagacatgaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2268453 |
ggttcattctatttaaggataacttagtctgttgccactttcgttattagttgatttatcagttaatttatgtctatcacttgattttttcagacatgaa |
2268552 |
T |
 |
| Q |
236 |
aaaactttgtatattagttaat |
257 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2268553 |
aaaactttgtatattagttaat |
2268574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University