View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_52 (Length: 250)
Name: NF8085_high_52
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 183 - 239
Target Start/End: Original strand, 31593213 - 31593268
Alignment:
| Q |
183 |
gttgatgtataggattaagaatttagtccaagtgcacaaacttttctttactttctt |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31593213 |
gttgatgtataggat-aagaatttagtccaagtgcacaaacttttctttactttctt |
31593268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 31593051 - 31593089
Alignment:
| Q |
25 |
attacatcttgatctacatcatcaataaattgatggggt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
31593051 |
attacatcttgatctacatcatcaataaatggttggggt |
31593089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University