View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_54 (Length: 249)
Name: NF8085_high_54
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 72
Target Start/End: Original strand, 5267166 - 5267231
Alignment:
| Q |
7 |
tttggaggtgaagttcaaaatcaatagttgatcctcaagctagtagacactttttgaaatgtgtca |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5267166 |
tttggaggtgaagttcaaaatcaatagttgatcctcaagctggtagacactttttgaaatgtgtca |
5267231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 196 - 249
Target Start/End: Original strand, 5267253 - 5267306
Alignment:
| Q |
196 |
tttactttgtctattgatggctggaatggcatttggttatgattttttctttaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5267253 |
tttactttgtctattgatggctggaatggcatttggttatgatttttcctttaa |
5267306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 84 - 119
Target Start/End: Original strand, 5267127 - 5267162
Alignment:
| Q |
84 |
taatcgatttagaatgatattatagtgaaacactct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5267127 |
taatcgatttagaatgatattatagtgaaacactct |
5267162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 5272445 - 5272485
Alignment:
| Q |
7 |
tttggaggtgaagttcaaaatcaatagttgatcctcaagct |
47 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
5272445 |
tttggaggtgaagttcacaatcaatagttaatcctcaagct |
5272485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University