View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8085_high_54 (Length: 249)

Name: NF8085_high_54
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8085_high_54
NF8085_high_54
[»] chr2 (4 HSPs)
chr2 (7-72)||(5267166-5267231)
chr2 (196-249)||(5267253-5267306)
chr2 (84-119)||(5267127-5267162)
chr2 (7-47)||(5272445-5272485)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 72
Target Start/End: Original strand, 5267166 - 5267231
Alignment:
7 tttggaggtgaagttcaaaatcaatagttgatcctcaagctagtagacactttttgaaatgtgtca 72  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
5267166 tttggaggtgaagttcaaaatcaatagttgatcctcaagctggtagacactttttgaaatgtgtca 5267231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 196 - 249
Target Start/End: Original strand, 5267253 - 5267306
Alignment:
196 tttactttgtctattgatggctggaatggcatttggttatgattttttctttaa 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
5267253 tttactttgtctattgatggctggaatggcatttggttatgatttttcctttaa 5267306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 84 - 119
Target Start/End: Original strand, 5267127 - 5267162
Alignment:
84 taatcgatttagaatgatattatagtgaaacactct 119  Q
    ||||||||||||||||||||||||||||||||||||    
5267127 taatcgatttagaatgatattatagtgaaacactct 5267162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 5272445 - 5272485
Alignment:
7 tttggaggtgaagttcaaaatcaatagttgatcctcaagct 47  Q
    ||||||||||||||||| ||||||||||| |||||||||||    
5272445 tttggaggtgaagttcacaatcaatagttaatcctcaagct 5272485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University