View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_57 (Length: 234)
Name: NF8085_high_57
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 7022542 - 7022339
Alignment:
| Q |
16 |
attaaaatcttgcagaatgatgatgttgacgacgatgatttaaatgataaagattctggggatggtattatcactttactggttcaatgcatttttcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7022542 |
attaaaatcttgcagaatgatgatgttgacgacgatgatttaaatgataaagattctggggatggtattatcactttactggttcaatgcatttttcatt |
7022443 |
T |
|
| Q |
116 |
tacttatccaccgtattccaaatttcaaccgcagcctgttttagtgcaatcaacttc-nnnnnnnaaggaattcgtaattctccagcttaactaagtata |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7022442 |
tacttatccactgtattccaaatttcaaccgcagcctgttttagtgcaatcaacttcttttttttaaggaattcgtaattctccagcttaactacgtata |
7022343 |
T |
|
| Q |
215 |
tttt |
218 |
Q |
| |
|
|||| |
|
|
| T |
7022342 |
tttt |
7022339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 11003212 - 11003170
Alignment:
| Q |
16 |
attaaaatcttgcagaatgatgatgttgacgacgatgatttaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11003212 |
attaaaatcttgcagaatgatgatgttgacgacaatgatttaa |
11003170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 171
Target Start/End: Complemental strand, 11122913 - 11122820
Alignment:
| Q |
78 |
tggtattatcactttactggttcaatgcatttttcatttacttatccaccgtattccaaatttcaaccgcagcctgttttagtgcaatcaactt |
171 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| | || ||| |||||||||||||||| | | | ||||||| |||||||||||| |
|
|
| T |
11122913 |
tggtattatcactttactgtttcaacgcatttttcattcattttgccatcgtattccaaatttcagctgtgacgtgttttactgcaatcaactt |
11122820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University