View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_60 (Length: 222)
Name: NF8085_high_60
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 51839306 - 51839513
Alignment:
| Q |
4 |
catacataactcttcgttcttttcacttcttcctttcnnnnnnnacaaactctttcttcccctcaaaacttccaaagagaacgtaattgaagtcttatca |
103 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51839306 |
catacatagctcttcgttcttttcacttcttcctttctttttttacaaactctttcttcccctcaaaactttcaaagagaacgtaattgaagtcttatca |
51839405 |
T |
 |
| Q |
104 |
agaattgttggttcaagacaaaaaagatgttaaaactcaaagccctctgattttcattgaaaatggtctccaataatatgtatttcagccttgaggtaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
51839406 |
agaattgttggttcaagacaaaaaagatgttaaaactcaaagccctgtgattttcattgaaaatggtctccaataatctgaatttcagccttgaggtaag |
51839505 |
T |
 |
| Q |
204 |
aataatct |
211 |
Q |
| |
|
||||||| |
|
|
| T |
51839506 |
gataatct |
51839513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University