View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_high_62 (Length: 218)
Name: NF8085_high_62
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_high_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 8251970 - 8252154
Alignment:
| Q |
18 |
agattcatactcagacccatcattttcttttgatttctttactataatatcatgtacttttctggtccaggcaataatacactcttatcccatgtacatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8251970 |
agattcatactcagacccatcattttcttttgatttctttactataatatcatgtacttttctggtccaggcaataatacactcttatcccatgtacatt |
8252069 |
T |
 |
| Q |
118 |
attactttctatacatttgcatcttctcttggttttttctatccatccatcccccaccacaatgaatcgtggataccaaacacga |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
8252070 |
attacttactatacatttgcatcttctcttggttttttctatctatccatcccccaccacaatgatttatggataccaaacacga |
8252154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University