View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_32 (Length: 353)
Name: NF8085_low_32
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 18 - 343
Target Start/End: Original strand, 33770373 - 33770698
Alignment:
| Q |
18 |
actagaattgtttttctcctctttccagtagcgcaataggtatggcagctgatggttggatggcactcatggatcgccttttgatattaccaaatgacag |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770373 |
actagaattatttttctcctctttccagtagcgcaataggtatggcagctgatggttggatggcactcatggatcgccttttgatattaccaaatgacag |
33770472 |
T |
 |
| Q |
118 |
aagtaaagaaaaggagcaagtaaaggaaaatatgtataaattgattgatttatactatgaggcattagacgctcctaagaaaggtggtggaaaggttagt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770473 |
aagtatagaaaaggagcaagtaaaggaaaatatatataaattgattgatttatactatgaggcattagacgctcctaagaaaggtggtggaaaggttagt |
33770572 |
T |
 |
| Q |
218 |
tctgtatcattcttcagttgcaatacagtctgcctctagtttttaggctaatcgccttttaacacacccaatcataatcagccaaataactcacttcttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770573 |
tctgtatcattcttcagttgcaatacagtctgcctctagtttttgggctaatcgccttttaacacacccaatcataatcagccaaataactcacttcttt |
33770672 |
T |
 |
| Q |
318 |
tattcatttaactggtcacaggttct |
343 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
33770673 |
tattcatttaactggtcaccggttct |
33770698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 273 - 301
Target Start/End: Complemental strand, 33771458 - 33771430
Alignment:
| Q |
273 |
cttttaacacacccaatcataatcagcca |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33771458 |
cttttaacacacccaatcataatcagcca |
33771430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University