View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_34 (Length: 348)
Name: NF8085_low_34
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 5 - 154
Target Start/End: Original strand, 34170423 - 34170572
Alignment:
| Q |
5 |
tattgttgaaaaattctctggttatgaacnnnnnnnagtaaatcttgttatgcatttgtttatataaaaatggagagatgagaaaagacttttacatttt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34170423 |
tattgttgaaaaattctctggttatgaactttttttagtaaatcttgttatgcatttgtttgtataaaaatggagagatgagaaaagacttttacatttt |
34170522 |
T |
|
| Q |
105 |
ttaacaagtcatatctaaaagttttggatcctaaaaatagaaaatttagg |
154 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
34170523 |
ttaacaagtcatatcttaaagttttggatcctaagaatagaaaatttagg |
34170572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 98 - 154
Target Start/End: Original strand, 34173940 - 34173996
Alignment:
| Q |
98 |
acattttttaacaagtcatatctaaaagttttggatcctaaaaatagaaaatttagg |
154 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34173940 |
acattgtttaacaagttatctctaaaagttttggatcttaaaaatagaaaatttagg |
34173996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 264
Target Start/End: Original strand, 34170650 - 34170683
Alignment:
| Q |
231 |
agataatagatttatgaataaacaattgtgtgta |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34170650 |
agataatagatttatgaataaacaattgtgtgta |
34170683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University