View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_45 (Length: 294)
Name: NF8085_low_45
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 152 - 277
Target Start/End: Complemental strand, 29857737 - 29857611
Alignment:
| Q |
152 |
aacagaattttaatatttcactgcatctggacataataatatatgttttcccacattatccaccc-nnnnnnnctaattataaagttaacttattcattt |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
29857737 |
aacagaattttaatatttcactgcatcaggaaataataatctatgttttctcacattatccacccaaaaaaatttaattataaagttaatttattcattt |
29857638 |
T |
 |
| Q |
251 |
tccaatatcttgtttcatgactcagtt |
277 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
29857637 |
tccaatatcttgtttcatgattcagtt |
29857611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 43 - 104
Target Start/End: Complemental strand, 29858065 - 29858004
Alignment:
| Q |
43 |
atattaggtgttggtagcaagatagacaatttgaggtaacaatgacaaactcaaaaaccata |
104 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| ||| | | |||||||||||||||| |
|
|
| T |
29858065 |
atattaggtgttggttgcaagatacacaatttgaggtgacacttagaaactcaaaaaccata |
29858004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University