View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_46 (Length: 293)
Name: NF8085_low_46
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 5267424 - 5267682
Alignment:
| Q |
17 |
aaaattatccattatgtcttctataatgtttattctcatagtcaagcgctttgagttagtaaagctttgtagtatcgttgaagctctatgtgctataaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5267424 |
aaaattatccattatgtcttctataatgtttattctcatagtcaagcgctttgagttagtaaagctttgtagtatcgttgaagctctatgtgctataaca |
5267523 |
T |
 |
| Q |
117 |
ttgagccaaggatgctccaccttatctatagatagaaagctctatgatgggaaaactatcacgttaggtttggagagagatcaaacctattatattaacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
5267524 |
ttgagccaaggatgctccaccttatctatagatagaaagctctatgatgggaaaactatcacgttaggtttggagagagatcggacctattagattaacg |
5267623 |
T |
 |
| Q |
217 |
agcatggagagcagatgcaagcttttaatttcaatagcgggcaaaatgactacaggatc |
275 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5267624 |
aatagggagagcagatgcaagcttttaatttcaatagcgggcaaaatgactacaggatc |
5267682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 273
Target Start/End: Original strand, 48781920 - 48782002
Alignment:
| Q |
191 |
gagagatcaaacctattatattaaccagcatggagagcagatgcaagcttttaatttcaatagcgggcaaaatgactacagga |
273 |
Q |
| |
|
|||||||| |||||||| |||||| | | ||||||||||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
48781920 |
gagagatcggacctattagattaacgaatagggagagcagatgcaagctttttctttcaatagacggccaaatgactacagga |
48782002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University