View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_47 (Length: 289)
Name: NF8085_low_47
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 4 - 234
Target Start/End: Complemental strand, 38368200 - 38367970
Alignment:
| Q |
4 |
aatatgtagttggtgtttataatcttcagatacggttgtatttgatcaaacatgaattccagaagttctaggattttgtatgggannnnnnnnnnnncct |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38368200 |
aatatgtagttggtgtttataatcttcagatacggttgtatttgatcaaacatgaattccagaagttctaggattttgtatgggatttttcttttttcct |
38368101 |
T |
 |
| Q |
104 |
cccaaaggctagatatgtgtgaagatgtgatgttattgacaaaatgcaagacattttaccttgtgtgcctaaatgatccaagcaaacaaatgttgaaaaa |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38368100 |
cccaaaggctagatatgggtgaagatgtgatgttattgacaaaatgcaagacattttaccttgtgtgcctaaatgatccaagcaaacaaatgttgaaaaa |
38368001 |
T |
 |
| Q |
204 |
tttggtacatactacggtaatttgtagttct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38368000 |
tttggtacatactacggtaatttgtagttct |
38367970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 231 - 285
Target Start/End: Complemental strand, 38367821 - 38367767
Alignment:
| Q |
231 |
ttctattctacaaatctaatgagttgtttgctcaacaattatggtccctttgatg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367821 |
ttctattctacaaatctaatgagttgtttgctcaacaattatggtccctttgatg |
38367767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University