View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_52 (Length: 266)
Name: NF8085_low_52
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_52 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0148 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 27074 - 26885
Alignment:
| Q |
1 |
gttgattgccatggctggaaacattctacctgtagtaaaggaaagaggtgtctttgcaatgcaaactataactggaatggcgaatctttaatttgtacca |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27074 |
gttgattgccatggctggaaccattctacttgtagtaaaggaaagaggtgtctttgcaatgcaaactataactggaatggcgaatctttaaattgtacca |
26975 |
T |
|
| Q |
101 |
aaagtaagtattaatattctattattcatgtaactaagaatattacaaattcacttaatttgatgaatttggattatagctgaagttgaaaaggtaaa |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26974 |
aaagtaagtattaat--------attcatgtaactaagaatattacaaattcacttaatttgatgaatttggattatagctgaagttaaaaaggtaaa |
26885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 1920 - 1838
Alignment:
| Q |
1 |
gttgattgccatggctggaaacattctacctgtagtaaaggaaagaggtgtctttgcaatgcaaactataactggaatggcga |
83 |
Q |
| |
|
||||||| | |||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
1920 |
gttgatttctatggttggaaacattctacctgtagtaaaggaaacaagtgtctttgcaatgcaaagtataaatggagtggcga |
1838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University