View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_53 (Length: 264)
Name: NF8085_low_53
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 40648004 - 40648119
Alignment:
| Q |
1 |
atgaaataatgaaatttatactcaacggtattttgcctcttggttatgcctttgatcatgtagttatgtttcttccgtgaacttgcatacattagtcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648004 |
atgaaataatgaaatttatactcaacggtattttgcctcttggttatgcctttgaccatgtagttatgtttcttccgtgaacttgcatacattagtcccc |
40648103 |
T |
 |
| Q |
101 |
actccttaaaacccca |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40648104 |
actccttaaaacccca |
40648119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 143 - 246
Target Start/End: Original strand, 40648146 - 40648249
Alignment:
| Q |
143 |
caccttataaatcacccaataatcttagtattttcttcttatacttatactagtttttagttaaaaaccctcaagaaatttgtgcatgtcatacatggat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648146 |
caccttataaatcacccaataatcttagtattttcttcttatacttctactagtttttagttaaaaaccctcaagaaatttgtgcatgtcatacatggat |
40648245 |
T |
 |
| Q |
243 |
ctaa |
246 |
Q |
| |
|
|||| |
|
|
| T |
40648246 |
ctaa |
40648249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University