View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_60 (Length: 241)
Name: NF8085_low_60
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 7131811 - 7131594
Alignment:
| Q |
14 |
catcattaatttcatcccaactaatgtcttcttcctcaggcatggaaggctagctccaaacaatcgatatatgactatctttgcatgatttgacactgtt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7131811 |
catctttaatttcatcccaactaatgtcttcttcctcaggcatggaaggctagctccaaacaatcgatatatgactatctttgcatgattcgacactgtt |
7131712 |
T |
 |
| Q |
114 |
atcattatctgtctacaattctgatgccacattttttacatccaacttatcatcttgatcactacagcagttaattacatgaacactagacactgtacat |
213 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7131711 |
atcattatctgtctacattcctgatgccacattttttacatccaacttatcatcttgatcactacagcagttaattacatgaacactagacactatacat |
7131612 |
T |
 |
| Q |
214 |
tgtcattataattcatct |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7131611 |
tgtcattataattcatct |
7131594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 21 - 176
Target Start/End: Complemental strand, 7123411 - 7123256
Alignment:
| Q |
21 |
aatttcatcccaactaatgtcttcttcctcaggcatggaaggctagctccaaacaatcgatatatgactatctttgcatgatttgacactgttatcatta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||| || |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
7123411 |
aatttcatcccaactaatgtcttcttcctcgggcatggaaggctggcttgaaacaattgaaatatcactatctttgcatgattcaccactgttatcatta |
7123312 |
T |
 |
| Q |
121 |
tctgtctacaattctgatgccacattttttacatccaacttatcatcttgatcact |
176 |
Q |
| |
|
|||| || || ||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7123311 |
tctgccttcacttcggatgccacattttttatatccaacttatcatcttgatcact |
7123256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University