View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8085_low_65 (Length: 220)
Name: NF8085_low_65
Description: NF8085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8085_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 38 - 202
Target Start/End: Original strand, 49910181 - 49910345
Alignment:
| Q |
38 |
agggcccgtttggtggccaagattaggagattatcatatcctactcaagtctattgtttgatgcacctataggatatgataaactaaccatatcactaat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49910181 |
agggcccgtttggtggccaagattaggagattatcatatcctactcaagtctattgtttgatgcacctataggatatgataaactaaccatatcattaat |
49910280 |
T |
 |
| Q |
138 |
tctatcttatttgtcttgcgttgctcttcctctctagtcgtctcgcatttgcaaccattgtgtct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49910281 |
tctatcttatttgtcttgcgttgctcttcctctctagtcgtctcgcgtttgcaaccattgtgtct |
49910345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University