View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8086_low_2 (Length: 229)
Name: NF8086_low_2
Description: NF8086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8086_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 5023865 - 5023750
Alignment:
| Q |
1 |
acaaagttgctgggtgcggatgaggctccggtgattaaggagacaagaaaacaatggggtgattttataggtactccctttctgaatcaattatatgagg |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5023865 |
acaaagttgctgggtgtggatgagactccagtgattaaggagacaagaaaacaatggggtgattttataggtactccctttctaaatcaattatatgagg |
5023766 |
T |
|
| Q |
101 |
agcatcttagtgagaa |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5023765 |
agcatcttagtgagaa |
5023750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 162 - 223
Target Start/End: Complemental strand, 5019567 - 5019506
Alignment:
| Q |
162 |
gtggcaatggtgcgtgatgactttcttgctctttcaagtctgttatactatattcttcgaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
5019567 |
gtggcaatggtgcgtgatgactttcttgctctttcaagtcggctatactattctcttcgaca |
5019506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University