View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_high_24 (Length: 344)
Name: NF8087_high_24
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 267766 - 267998
Alignment:
| Q |
17 |
tgtggatttccctatattactgtgatgtgattcatcatgatttggttcgaatttaatgaattaaagatgaagatccaactcaagtcttgaaatgaatgca |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267766 |
tgtggatttccgtatattactgtgatgtgattcatcatgatttggttcgaattttatgaattaaagatgaagatccaactcaagtcttgaaatgaatgca |
267865 |
T |
 |
| Q |
117 |
tgaatttttccatgtgcttgttgttttgtggaatattttgttctattcagcttcttttcattgtgtcttaatttcaacataaaattagtattcaattcag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267866 |
tgaatttttccatgtgcttgttgttttgtggaatattttgttctattcagcttcttttcat--tgtcttaatttcaacataaaattagtattcaattcag |
267963 |
T |
 |
| Q |
217 |
ctgggtgagaatatttcagtggaattttttgttga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
267964 |
ctgggtgagaatatttcagtggaattttttgttga |
267998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 249 - 315
Target Start/End: Original strand, 268030 - 268096
Alignment:
| Q |
249 |
tgaatattttatttttgtggaattggtctttctatgaccacctgcataatatttacttctgctgaac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
268030 |
tgaatattttatttttgtggaattggtctttctattaccacctgcataatatttacttctgctgaac |
268096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University