View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_high_26 (Length: 322)
Name: NF8087_high_26
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 15506140 - 15506244
Alignment:
| Q |
1 |
actattttagtctcaaaatcttgttaagagaactgcacttatctgtcgttcaccatgcaatggtagctaagtaccgttcgacactttttatattggtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15506140 |
actattttagtctcaaaatcttgttaagggaactgcacttatctgtcgttcaccatgcaatggtagctaagtacggttcgacactttttatattggtgta |
15506239 |
T |
 |
| Q |
101 |
atcac |
105 |
Q |
| |
|
||||| |
|
|
| T |
15506240 |
atcac |
15506244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 210 - 253
Target Start/End: Original strand, 15506360 - 15506403
Alignment:
| Q |
210 |
agtgcaatgagttttagtattcttcgtaattatttctcaatttt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15506360 |
agtgcaatgagttttagtattcttcgtaattatttctcaatttt |
15506403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 269
Target Start/End: Complemental strand, 15981339 - 15981285
Alignment:
| Q |
215 |
aatgagttttagtattcttcgtaattatttctcaattttaatattgatctatctg |
269 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15981339 |
aatgagttttagtgatcttcgtaattatttctcaattttaatattgatctgtctg |
15981285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 102
Target Start/End: Complemental strand, 16326868 - 16326800
Alignment:
| Q |
34 |
tgcacttatctgtcgttcaccatgcaatggtagctaagtaccgttcgacactttttatattggtgtaat |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| |||| |||||||||| || |||||||| |
|
|
| T |
16326868 |
tgcaattatctgtcgttcaccatgcaatggtagataagtattgttcaacactttttaaatcggtgtaat |
16326800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 102
Target Start/End: Complemental strand, 16350266 - 16350198
Alignment:
| Q |
34 |
tgcacttatctgtcgttcaccatgcaatggtagctaagtaccgttcgacactttttatattggtgtaat |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| |||| |||||||||| || |||||||| |
|
|
| T |
16350266 |
tgcaattatctgtcgttcaccatgcaatggtagataagtattgttcaacactttttaaatcggtgtaat |
16350198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 16326664 - 16326617
Alignment:
| Q |
215 |
aatgagttttagtattcttcgtaattatttctcaattttaatattgat |
262 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
16326664 |
aatgagttttagtgatcttcgtaattaattctcaattttaatattgat |
16326617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 16350062 - 16350015
Alignment:
| Q |
215 |
aatgagttttagtattcttcgtaattatttctcaattttaatattgat |
262 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
16350062 |
aatgagttttagtgatcttcgtaattaattctcaattttaatattgat |
16350015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 15981570 - 15981497
Alignment:
| Q |
1 |
actattttagtctcaaaatcttgttaagagaactgcacttatctgtcgttcaccatgcaatggtagctaagtac |
74 |
Q |
| |
|
|||||||||||| |||||| |||| ||| |||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15981570 |
actattttagtcctaaaatcccattaacagagttgcaattatctgtcgttcaccatgcaatggtagataagtac |
15981497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University