View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_high_29 (Length: 297)
Name: NF8087_high_29
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 40260245 - 40259970
Alignment:
| Q |
1 |
atataatactaacagcatattcttgacaaatattctagagatatcttataatataagtgtaatattctacagatattctacaaaaggcttctagaaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40260245 |
atataatactaacagcatattcttgacaaatattctagagatatcttataatataagtgtaatattctacagatattctacaaaaggcttctagaaattt |
40260146 |
T |
 |
| Q |
101 |
gtattaaacttaaataatggcaaaggttgatagaaccgaaactggaagctgagcagtaaaggcaaatgatcagggaagaagcatttctttctgtctttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40260145 |
gtattaaacttaaataatggcaaaggttgatagaaccgaaactggaagctgagcagtaaaggcaaatgatcagggaagaagcatttctttctgtctttca |
40260046 |
T |
 |
| Q |
201 |
taaaaagcatggaaagttcccgatgtattttgctggctttctttctcaaactcctttgccagttgattctccatgg |
276 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40260045 |
taaaaagcatggaaaattcccgatgtattttgctggctttctttctcgaactcctttgccagttgattctccatgg |
40259970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 40260589 - 40260505
Alignment:
| Q |
130 |
atagaaccgaaactggaagctgagcagtaaaggcaaatgatcagggaagaagcatttctttctgtctttcataaaaagcatggaa |
214 |
Q |
| |
|
||||||| |||||||||||||||||| |||| | | ||||| ||||||| | || |||||| |||||||||||| || ||||| |
|
|
| T |
40260589 |
atagaactgaaactggaagctgagcaagaaagacgacggatcatggaagaaacgttgctttctttctttcataaaatgcttggaa |
40260505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University