View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_high_37 (Length: 252)
Name: NF8087_high_37
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 1677037 - 1676817
Alignment:
| Q |
18 |
aagaagctcctccaccaccaagcatgaccaacaaatggaagaaataaacttggtctaactaagcatttgcttgcaataaaccaaccaagtaaaagtagta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1677037 |
aagaagctcctccaccaccaagcatgaccaacaaagggaagaaataaacttggtctaactaagcatttgcttgcaataaaccaaccaagtaaaagtagta |
1676938 |
T |
 |
| Q |
118 |
attcccttcacaaactaagatatattggaaaattggatgtgttaattggttttagctttttgtagaagctaaaagaatttgaaatattcatcatcttgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1676937 |
attcccttcacaaactaagatatattggaaaattggatgtgttaattggttttagctttttgtaaaagctaaaagaatttgaaatattcatcatcttgat |
1676838 |
T |
 |
| Q |
218 |
gcccttgccaaaaacacaggt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1676837 |
gcccttgccaaaaacacaggt |
1676817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University