View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_26 (Length: 336)
Name: NF8087_low_26
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 103 - 321
Target Start/End: Complemental strand, 11368413 - 11368195
Alignment:
| Q |
103 |
ctcacttatgcaaaagcatagaagagaatccaaaattggtgtgtctaaccaagaaaaatactccacacagcataaaaatagctcctgagtatcttttgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368413 |
ctcacttatgcaaaagcatagaagagaatccaaaattggtgtgtctaaccaagaaaaatactccacacagcataaaaatagctcctgagtatcttttgga |
11368314 |
T |
 |
| Q |
203 |
agaaaaagaaaaggaccatagagaataggctctgcaagataaaagttgaaagaattagaggccaagtagcatattatcaacttatcaatgttaaagcatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368313 |
agaaaaagaaaaggaccatagagaataggctctgcaagataaaagttgaaagaattagaggccaagtagcatattatcaacttatcaatgttaaagcatg |
11368214 |
T |
 |
| Q |
303 |
ctcaggtttatgtttacct |
321 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11368213 |
ctcaggtttatgtttacct |
11368195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University