View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_28 (Length: 315)
Name: NF8087_low_28
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 123 - 296
Target Start/End: Complemental strand, 31645688 - 31645515
Alignment:
| Q |
123 |
atataaacactttcatatgattttactacgtaggtggtcatgcaaagacactcgtgttagtccaaattaattcagacataaagtcttgctctgaatcttt |
222 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31645688 |
atatgaacattttcatatgattttactatgtaggtggtcatgcaaagacactcatgttagtccaaattaattcagacataaagtcttactctgaatcttt |
31645589 |
T |
 |
| Q |
223 |
gtgtactttaaagtttgctgaaagggtttctggagttgagttaggagttgcaagaagtacaaaagagggaagag |
296 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31645588 |
gagtactttaaagtttgctgaaagggtttctggagttgagttaggagttgcaagaagtacaaaagagggaagag |
31645515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 267
Target Start/End: Complemental strand, 40982149 - 40982109
Alignment:
| Q |
227 |
actttaaagtttgctgaaagggtttctggagttgagttagg |
267 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40982149 |
actttgaagtttgctgaaagggtttctggtgttgagttagg |
40982109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University