View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_34 (Length: 273)
Name: NF8087_low_34
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 16 - 97
Target Start/End: Complemental strand, 29654584 - 29654503
Alignment:
| Q |
16 |
aatatattatgtacatttgcataggggaatagaacagaacaatcccctttttctcataacaagaatataatagtggacatat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654584 |
aatatattatgtacatttgcataggggaatagaacagaacaatcccctttttctcataacaagaatataatagtggacatat |
29654503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 162 - 258
Target Start/End: Complemental strand, 29654439 - 29654343
Alignment:
| Q |
162 |
ctttttctagttatcagaaattagtggaaatcattctaccnnnnnnnnttagtggaaatcaagctggtctaattagaagacatctttatgtagtagc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654439 |
ctttttctagttatcagaaattagtggaaatcattctaccaaaaaaaattagtggaaatcaagctggtctaattagaagacatctttatgtagtagc |
29654343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University