View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_37 (Length: 268)
Name: NF8087_low_37
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_37 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 15412407 - 15412662
Alignment:
| Q |
13 |
aagaatatgattgtgaataatatgagatatatattgtacatagagtgtctccaaatcatggttagcttctttctattttattaattttttattggttcaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15412407 |
aagaatatgattgtgaataatatgagatatatattgtacatagagtgtctccaaatcatgcttagcttctttctattttattaattttttattggttcaa |
15412506 |
T |
 |
| Q |
113 |
attttagaaagggagtaagatactatgatatactccaaggttaatttacaaggttaattccctaaacattgtttattcgtatgtttggattaaggcgggt |
212 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15412507 |
attttaaaaagggagtaagacactatgatataccgcaaggttaatttacaaggttaatttcctaaacattgtttattcgtatgtttggattaaggcgggt |
15412606 |
T |
 |
| Q |
213 |
ttgatacaatgtgatttaaatgaaactctaaaatgtagcttttatcaaaatcgcaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15412607 |
ttgatacaatgtgatttaaatgaaactctaaaatgtagcttttatcaaaatcgcaa |
15412662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University