View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_40 (Length: 247)
Name: NF8087_low_40
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 30475689 - 30475903
Alignment:
| Q |
12 |
agtgagatgaaggggagaaacatgatgcataaccagagaaaaactctttccttcacaatttggttgcatgcgtccatgtttttagaggcgcgccagtcga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
30475689 |
agtgtgatgaaggggagaaacatgatgcataaccagggaaaaactctttgcttcacaatttggttgcatgcgtccgtgtttttagaggcgcgcgagtcga |
30475788 |
T |
|
| Q |
112 |
aggttttgatcagcctaagtaatttagtttcaatgaacaattggccatgatcttgctgaaattcaaactgcaattacaatgacatttttgtactgtctct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30475789 |
aggttttgatcagcctaagtaatttagtttcaatgaacaattggcaatgatcttgctgaaattcaaactgcaattacaatgacatttttgtactatctct |
30475888 |
T |
|
| Q |
212 |
tgcatcgtagaagat |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30475889 |
tgcatcgtagaagat |
30475903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University