View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_41 (Length: 245)
Name: NF8087_low_41
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 40260439 - 40260222
Alignment:
| Q |
19 |
acatttactaatcaattttgaagtagaaatatattgttctactttctatcggataaaattatactgtgcttatcctgtataatttcaggcacaaaatgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40260439 |
acatttactaatcaattttgaagtagaaatatattgttctactttctatcggataaaattatactgtgcttatcccatataatttcaggcacaaaatgaa |
40260340 |
T |
 |
| Q |
119 |
gaaaatgaagatcagactttatttgatgtatccatacagtccctctgaattagtcataactaaaatatcgttaaggaggtttgttaatgtattaatataa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40260339 |
gaaaatgaagatcagactttatttgatgtatccatacagtccctctgaattagtcataactaaaatatcgttaaggaggtttgttaatgtattaatataa |
40260240 |
T |
 |
| Q |
219 |
tactaacagcatattctt |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40260239 |
tactaacagcatattctt |
40260222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University