View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8087_low_44 (Length: 241)
Name: NF8087_low_44
Description: NF8087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8087_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 48155486 - 48155279
Alignment:
| Q |
16 |
aagaaaagacatcaatattgtatttgtatctacttggggatggctattacgaagtttgtgtgctgtttaaaaatgtggcgctgctgcacgcggatgaata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48155486 |
aagaaaagacatcaatattgtatttgtatctacttggggatggctattacaaattttgtgtgctgtttaaaaatgtggcgctgctgcacgcggataaata |
48155387 |
T |
 |
| Q |
116 |
ccttgcacagctttccttccaatcatccagcagttgaattgctttcacacacttgacttgagtatttgtttctgatacattgttccaaagcttagtattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48155386 |
ccttgcacagctttccttccaatcatccagcagttgaattgctttcacacacttaacttgagtacttgtttctgatacattgttccaaagcttagtattt |
48155287 |
T |
 |
| Q |
216 |
gctgtttt |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
48155286 |
gctgtttt |
48155279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University