View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8088_low_20 (Length: 338)
Name: NF8088_low_20
Description: NF8088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8088_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 32758332 - 32758023
Alignment:
| Q |
1 |
tcaaagaatgaataccgttagagaagcttctgtgaaagagagagatcctgaggtatgatgctgctcttgaagcccataactgcctgcaagccatcgtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32758332 |
tcaaagaatgaataccgttagagaagcttctgtgaaagagagagatcctgaggtatgatgctgctcttgaagcccataactgcctgcaagccatcttttt |
32758233 |
T |
 |
| Q |
101 |
ctctctactctgtctgcctgcgattgtccgtccacttacactgaatgaatgaatgaaattattaccctttttatattggtgtggttggtgacaaaggaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32758232 |
ctctctactctgtctgcctgcgattgattgtccacttacactgaatgaatgaa----attattaccctttttatattggtgtggttggtgacaaaggaaa |
32758137 |
T |
 |
| Q |
201 |
ctgagagagagtgaagagtggtagggttaaggaagttggtgagtggggtacatttgatggattttggaggagctatcagccagacacgtcatgggcatgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32758136 |
ctgagagagagtgaagagtggtagggttaaggaagttggtgagtggggtacatttgatggattttggaggagctatcagccagacacgtcatgggcatgc |
32758037 |
T |
 |
| Q |
301 |
ctgtgttgtcccac |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32758036 |
ctgtgttgtcccac |
32758023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University