View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8088_low_23 (Length: 319)
Name: NF8088_low_23
Description: NF8088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8088_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 285
Target Start/End: Complemental strand, 39403392 - 39403124
Alignment:
| Q |
17 |
caaagaaatattgtttattaagaatctgatcgtgaatggaggaagagaggaacccataacggtttttggataatattcccttgatatttctgggttccaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403392 |
caaagaaatattgtttattaagaatctgatcgtgaatggaggaagagaggaacccataacggtttttggataatattcccttgatatttctgggttccaa |
39403293 |
T |
|
| Q |
117 |
ttgaaggaagggggaccnnnnnnnnngttttgtttgtgtgctttggcagttctgtacagatttaattggaaaagatatttcgacccttaattttaatcca |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403292 |
ttgaaggaagggggacctttttttttgttttgtttgtgtgcttcggcagttctgtacagatttaattggaaaagatatttcgacccttaattttaatcca |
39403193 |
T |
|
| Q |
217 |
acggttgtaatttattgctctcatctctcaccacaagttagtcttctcattttatacatccccgacaca |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403192 |
acggttgtaatttattgctctcatctctcaccacaagttagtcttctcattttatacatccccgacaca |
39403124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 143 - 246
Target Start/End: Original strand, 39403681 - 39403784
Alignment:
| Q |
143 |
gttttgtttgtgtgctttggcagttctgtacagatttaattggaaaagatatttcgacccttaattttaatccaacggttgtaatttattgctctcatct |
242 |
Q |
| |
|
||||||||||||||||| | ||||| || |||||||||| |||||| |||| || | |||| ||||||||||| ||| |||||||| |||||||| ||| |
|
|
| T |
39403681 |
gttttgtttgtgtgcttcagtagttccgtccagatttaatcggaaaaaatatctcaatccttgattttaatccagcggctgtaatttgttgctctcgtct |
39403780 |
T |
|
| Q |
243 |
ctca |
246 |
Q |
| |
|
|||| |
|
|
| T |
39403781 |
ctca |
39403784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Original strand, 7588169 - 7588209
Alignment:
| Q |
206 |
attttaatccaacggttgtaatttattgctctcatctctca |
246 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
7588169 |
attttaatccaacggttgtcctttaatgctctcatctctca |
7588209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University