View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8088_low_27 (Length: 234)
Name: NF8088_low_27
Description: NF8088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8088_low_27 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 6203481 - 6203698
Alignment:
| Q |
17 |
atagccttaatacgtgcatcattaacaacagaagacgaatttgattgaacctttctccgactaattttatcgttctcatccggcgcaaactccttaagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6203481 |
atagccttaatacgtgcatcattaacaacagaagacgaatttgattgaacctttctccgactaattttatcgttctcatccggcgcaaactccttaagaa |
6203580 |
T |
|
| Q |
117 |
catcatctacaatactctcacaaaccttatcatctctacttttcttaaaattagcagaagtaaacatcgacgaaactcttgatccgcccatcatagcagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6203581 |
catcatctacaatactctcacaaaccttatcatctctacttttcttaaaattagcagaagtaaacatcgacgaaactcttgatccgcccatcatagcagc |
6203680 |
T |
|
| Q |
217 |
agcagctgataatttagc |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6203681 |
agcagctgataatttagc |
6203698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University