View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8088_low_28 (Length: 231)
Name: NF8088_low_28
Description: NF8088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8088_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 112 - 216
Target Start/End: Complemental strand, 32557798 - 32557694
Alignment:
| Q |
112 |
ccataagaaatgtgtactgaaggataggtaaaaaaggggacaaggatgtgggttgtctggaaattgggtccaaaccaagattaagggtgtatgagaggag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557798 |
ccataagaaatgtgtactgaaggataggtaaaaaaggggacaaggatgtgggttgtctgggaattgggtccaaaccaagattaagggtgtatgagaggag |
32557699 |
T |
 |
| Q |
212 |
aaggg |
216 |
Q |
| |
|
||||| |
|
|
| T |
32557698 |
aaggg |
32557694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 32557870 - 32557796
Alignment:
| Q |
1 |
gacagggaagtgcaaaggaaataatggacaagaaaagaaccttcaagtatgtattgaatcccatcttcccatcca |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557870 |
gacagggaagtgcaaaggaaataatggacaagaaaagaaccttcaagtatgtattgaatcccatcttcccatcca |
32557796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University