View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8088_low_29 (Length: 231)
Name: NF8088_low_29
Description: NF8088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8088_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 52379372 - 52379564
Alignment:
| Q |
13 |
aagaaacaaaaagaaatattctatttttcgtattactcttatgatatctttttcttgttaaagaaggaaatattattggtgcaggacagcatgcgcaagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379372 |
aagaaacaaaaagaaatattctatttttcgtattactcttatgatatctttttcttgttaaagaaggaaatattattggtgcaggacagcatgcgcaagc |
52379471 |
T |
 |
| Q |
113 |
atattgtatctcgcacggtgtgcgagttagatggatggttgggtggccatatctatacatacttcatgggattaaattttaaaagactgggta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
52379472 |
atattgtatctcgcacggtgtgcgagttagatggatggttgggtggccatatctatacattcttcatgggattaaattttaaaaaactgggta |
52379564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University