View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8089_high_5 (Length: 316)

Name: NF8089_high_5
Description: NF8089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8089_high_5
NF8089_high_5
[»] chr4 (1 HSPs)
chr4 (1-180)||(33821640-33821819)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 33821819 - 33821640
Alignment:
1 ctttgggcaagtctttcatttgtttgggcagagatctcatggcgagatgtacgaatttgatgtttctctccacaatctatgatgggtcggaaataacatt 100  Q
    |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
33821819 ctttgggcgagtctttcatttgtttgggcagagatctcatggcgagttgtacgaatttgatgtttatctccacaatctatgatgggtcggaaataacatt 33821720  T
101 tgaaggcggcagtctaaaaatcaaagttggtccaatctataactagattagagagttttgtagaggaggagagaagttcg 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
33821719 tgaaggcggcagtctaaaaatcaaagttggtccaatctataactagattagagagttttgtagaggacgagagaagttcg 33821640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University