View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8089_low_12 (Length: 316)
Name: NF8089_low_12
Description: NF8089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8089_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 33821819 - 33821640
Alignment:
| Q |
1 |
ctttgggcaagtctttcatttgtttgggcagagatctcatggcgagatgtacgaatttgatgtttctctccacaatctatgatgggtcggaaataacatt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33821819 |
ctttgggcgagtctttcatttgtttgggcagagatctcatggcgagttgtacgaatttgatgtttatctccacaatctatgatgggtcggaaataacatt |
33821720 |
T |
|
| Q |
101 |
tgaaggcggcagtctaaaaatcaaagttggtccaatctataactagattagagagttttgtagaggaggagagaagttcg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33821719 |
tgaaggcggcagtctaaaaatcaaagttggtccaatctataactagattagagagttttgtagaggacgagagaagttcg |
33821640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University