View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8089_low_13 (Length: 268)
Name: NF8089_low_13
Description: NF8089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8089_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 19797664 - 19797874
Alignment:
| Q |
20 |
gttctaaccgtggtcgctttctggtgtgcagttgtctgcatcattgctagagacaaagtccaggacggggaaagcaacatctagtgatgtttgatcaaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19797664 |
gttctaaccgtggtcgctttctggtgtgcagttgtctgcatcattgctaga--ccaagtccaggacggggaaagcaacatctagtgatgcttgatcaaag |
19797761 |
T |
 |
| Q |
120 |
aaaacattggtaaactaaagaggtacctttttccaagctacctcatgtaggaaaactggaaattcacattaggaatgttgttagttaagtctgttaggga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
19797762 |
aaaacattggtaaactaaagaggtacctttttccaagctactgcatgtaggaaaactggaaattgacattaggaatgttcttagttaagtctgttgggga |
19797861 |
T |
 |
| Q |
220 |
gttagttgattcg |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19797862 |
gttagttgattcg |
19797874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University