View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8089_low_14 (Length: 242)
Name: NF8089_low_14
Description: NF8089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8089_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 25 - 226
Target Start/End: Complemental strand, 32720146 - 32719945
Alignment:
| Q |
25 |
taatttacatataatgtcattctcaggttatcacgacgatgattgtgattttttctcc-gactttaaaattttcacgttatgtttttgtattgtgacagt |
123 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32720146 |
taatttacatataatgtcattctctggttatcacgatgatgattgtgattttttctccagactttaaaattttcacgttatgtttttgtattgtgaccgt |
32720047 |
T |
 |
| Q |
124 |
gttcttttatattctctgtacttaattttccgaacaactgggcacccccgtgaggcattacatcaacattacataaggataagggcaaacgaatggagat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32720046 |
gttcttttatattctctgtacttaattttccggacaactgggcacccccgtgaggcattacatcaacattacataaggataa-ggcaaacgaatggagat |
32719948 |
T |
 |
| Q |
224 |
gga |
226 |
Q |
| |
|
||| |
|
|
| T |
32719947 |
gga |
32719945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University