View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8089_low_15 (Length: 240)

Name: NF8089_low_15
Description: NF8089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8089_low_15
NF8089_low_15
[»] chr8 (1 HSPs)
chr8 (22-231)||(3688437-3688646)


Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 22 - 231
Target Start/End: Complemental strand, 3688646 - 3688437
Alignment:
22 accgcaatgtttcatattgttgcggcggttgaacaacctgaaacggtgtcatccaagaaacaacaccgtcaacaatctccgtcttctcccttttaaacac 121  Q
    ||||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
3688646 accgcaaagtttcatattgttgcggccgttgaacaacctgtaacggtgtcatccacgaaacaacaccgtcaacaatatccgtcttctcccttttaaacac 3688547  T
122 ctgctcacattccggcttcaggtctccggtctcgagacatgtctctcttttctgcactctttttctcttcacctccattctcctcaatgcttgaatctca 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3688546 ctgctcacattccggcttcaggtctccggtctcgagacatgtctctcttttctgcactctttttctcttcacctccattctcctcaatgcttgaatctca 3688447  T
222 cgtttcattt 231  Q
    ||||||||||    
3688446 cgtttcattt 3688437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University