View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8089_low_8 (Length: 362)
Name: NF8089_low_8
Description: NF8089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8089_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 3354229 - 3354406
Alignment:
| Q |
16 |
cacacggcttgttaatcagggctggatgacttgactttgggttagt------atgatgagaaattatcgcacatatctgttttaaatgactacatattac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354229 |
cacacggcttgttaatcagggctggatgacttgactttgggttagtaatagtatgatgagaaattatcgcacatatctgttttaaatgactacatattac |
3354328 |
T |
|
| Q |
110 |
atgcgacaaaatttatagaagaagcaaaaatttcatttgcaagcaagaagttgatgtcaggtatgatccattttaaag |
187 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354329 |
atgcgacaaaatttatagaagaagcacaaattccatttgcaagcaagaagttgatgtcaggtatgatccattttaaag |
3354406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 219 - 344
Target Start/End: Original strand, 54702661 - 54702786
Alignment:
| Q |
219 |
taaacatgcaatatgcatttgaatttatttatttttcaaaactgtgtatctctagatgaagcttgaacactacttctgcacccagtatcagtgcattttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702661 |
taaacatgcaatatgcatttgaatttatttatttttcaaaactgtgtatctctagatgaagcttgaacactacttctgcacccagtatcagtgcattttc |
54702760 |
T |
|
| Q |
319 |
catttctgaatcatcgtttagctgat |
344 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
54702761 |
catttctgaatcatcgtttagctgat |
54702786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University