View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8090_high_3 (Length: 278)
Name: NF8090_high_3
Description: NF8090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8090_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 133 - 259
Target Start/End: Complemental strand, 8272005 - 8271879
Alignment:
| Q |
133 |
caacaatgataaatttgcagtggctttactagggcacaatcaattttcaactatggagtccattcttgttgtaatagtggaatatttacgtttgtatgtt |
232 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
8272005 |
caacaatgataaatttgcagtggctttgctagagcacaatcaattttcaacaatggagtccattcttgttgtaatagtggaatgtttacatttgtatgtt |
8271906 |
T |
|
| Q |
233 |
ccatcgtcacaattcaggcctttaaga |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8271905 |
ccatcgtcacaattcaggcctttaaga |
8271879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 8272501 - 8272423
Alignment:
| Q |
7 |
tttcgtgtttaagagcacatcaaaggtgcgacaaatgcaaagctacaacttgtgcttctacaatatcacgatgattttg |
85 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8272501 |
tttcatgtttaagagcacatcaaaggtgcgacaaatgcaaagctacaacttgtgcttctacaatatcacggtgattttg |
8272423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University