View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8090_high_5 (Length: 208)
Name: NF8090_high_5
Description: NF8090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8090_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 2 - 192
Target Start/End: Original strand, 1505830 - 1506020
Alignment:
| Q |
2 |
ctagtggagtagcagagatgtacaaggtatcaataggaaacttagtttggttttgcatacaaggtcttgtagactgcgactaagtgagttatggatgttt |
101 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1505830 |
ctagtgtagtagaagaaatgtacaaggtatcaataggaaacttagtttggttttgcatacaaggtcttgtagactgcgactaagtgagttatggatgttt |
1505929 |
T |
 |
| Q |
102 |
ttgctataattaactaaatgtttttgaatatatttacaacaatagtataggattcgaggaggatgacccttatctgttttaggtaacaact |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1505930 |
ttgctataattaactaaatgtttttgaatatatttacaacaatagtataggattcgaggaggatgacccttatgtgttttaggtaacaact |
1506020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University