View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8090_low_4 (Length: 279)
Name: NF8090_low_4
Description: NF8090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8090_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 51033742 - 51033493
Alignment:
| Q |
18 |
atctcttacccagctatgtctatatataga--aacttcttgcagcattgttctttgaagcattatccttacccaaagcaagcttctgtccc-tctatcct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51033742 |
atctcttacccagctatgtctatatatatataaacttcttgcagtattgttctttgaagcattatccttacccaaagcaagcttctgtcccctctatcct |
51033643 |
T |
|
| Q |
115 |
acccnnnnnnnnn-gcttagtatactattataatatactttgcacaagagaaggcaaaaggaaaatttactaaatagttagttatggaagaagatattgt |
213 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51033642 |
acccaaaaaaaaaagcttagtatactattata---tactttgcacaagagaaggcaaaaagaaaatttactaaattgttagttatggaagaagatattgt |
51033546 |
T |
|
| Q |
214 |
gattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51033545 |
gattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
51033493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 200 - 266
Target Start/End: Original strand, 40611750 - 40611816
Alignment:
| Q |
200 |
gaagaagatattgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
40611750 |
gaagaagatattgtgattgtgggagctggaattgctggcctcacaacatccttggcacttcacaggt |
40611816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 200 - 266
Target Start/End: Complemental strand, 51036967 - 51036901
Alignment:
| Q |
200 |
gaagaagatattgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| || | |||| |||||| |
|
|
| T |
51036967 |
gaagaagatattgtgattgtgggagctggaattgctggactcacaacatccttaggactttacaggt |
51036901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 204 - 266
Target Start/End: Complemental strand, 51067607 - 51067545
Alignment:
| Q |
204 |
aagatattgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
266 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
51067607 |
aagatattgtgatcgtaggagctggaattgctggcctcacaacatccttgggacttcacaggt |
51067545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 51070242 - 51070205
Alignment:
| Q |
200 |
gaagaagatattgtgattgtgggagctggaattgctgg |
237 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51070242 |
gaagaagatgttgtgattgtgggagctggaattgctgg |
51070205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University