View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8091_high_24 (Length: 296)

Name: NF8091_high_24
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8091_high_24
NF8091_high_24
[»] chr3 (1 HSPs)
chr3 (12-276)||(37848399-37848644)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 37848644 - 37848399
Alignment:
12 ggatttttattacgagcacgatatcgtgaagtctttaatcagtgattttatcttaaactgaggcccatggtggttgtaaaaaagnnnnnnnnnnnaaaat 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||   || |||||                  |    
37848644 ggatttttattacgagcacgatatcgtgaagtctttaatcagtgattttatcttgaactgaggcccatgg-atttttaaaa------------------t 37848564  T
112 tgatttattacgagcatgattacattgaatgtttccgaaataacttacaaaaatcgaaaattaattgagggctttcgaagaagagatgataggaaacaat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||    
37848563 tgatttattacgagcatgattacattgaatgtttccgaaataacttacaaaaatcaaaaattgattgagggctttcgaagaagagatgataagaaacaat 37848464  T
212 ttgatcggtttaattttggtagatgatgtctgtggcagccggaattcgaaagtgacgatggcgct 276  Q
    |||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
37848463 ttgatcggttcaattttggaagatgaggtctgtggcagccggaattcgaaagtgacgatggcgct 37848399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University