View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_high_27 (Length: 262)
Name: NF8091_high_27
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 247
Target Start/End: Complemental strand, 17871473 - 17871230
Alignment:
| Q |
4 |
ctaatctaatctaatctaatcccttgcttaaaattccaccttatatgcttggtgactaatgagtgatactgtgattaatggagacaaatttctgtgtagg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17871473 |
ctaatctaatctaatctaatcccttgcttaaaattccaccttatacgcttagtgactaatgagtgatactgtgattaatggagacaaatttctgtgtagg |
17871374 |
T |
 |
| Q |
104 |
tgaggtcattagttggtgatagaatggctttgttggtacaaactttctcagcagtagcaacagcatacactatgggtctgatcatttcatggaggctgaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17871373 |
tgaggtcattagttggtgatagaatggctttgttggtacaagctttctcagcagtagcaacagcatacactatgggtctgatcatttcatggaggctcaa |
17871274 |
T |
 |
| Q |
204 |
ccttgttatgatcgccattcaaccgattataatagcttgctttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17871273 |
ccttgttatgatcgccattcaaccgattataatagcttgctttt |
17871230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University