View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_high_28 (Length: 256)
Name: NF8091_high_28
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_high_28 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 122 - 256
Target Start/End: Original strand, 5172272 - 5172406
Alignment:
| Q |
122 |
aattaacattatgatgtgcaacccaaccttgacttcagaaacttacttctcaatgtgtgagcttggagttggatcaaatatgtgaaagagattagaaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5172272 |
aattaacattatgatgtgcaacccaaccttgacttcagaaacttacttctcaatgtgtgagcttggagttggatcaaatatgtgaaagagattagaaaaa |
5172371 |
T |
 |
| Q |
222 |
tagagtgactgtaaaaaatgtctcttgttgccttc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5172372 |
tagagtgactgtaaaaaatgtctcttgttgccttc |
5172406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 5172195 - 5172272
Alignment:
| Q |
18 |
aatgccatgtttgaatatctctattatttnnnnnnngaaagaaggatggcagtttctctcacacataagttaattgcaa |
96 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5172195 |
aatgccatgtttgaatatttctattatttaaaaaa-gaaagcaggatggcagtttctctcacacttgagttaattgcaa |
5172272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University