View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8091_high_28 (Length: 256)

Name: NF8091_high_28

Description: NF8091

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF8091_high_28

[»] chr8 (2 HSPs)

Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 135; E-Value: 2e-70

Query Start/End: Original strand, 122 - 256

Target Start/End: Original strand, 5172272 - 5172406

Alignment:

Q	122	aattaacattatgatgtgcaacccaaccttgacttcagaaacttacttctcaatgtgtgagcttggagttggatcaaatatgtgaaagagattagaaaaa	221	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	5172272	aattaacattatgatgtgcaacccaaccttgacttcagaaacttacttctcaatgtgtgagcttggagttggatcaaatatgtgaaagagattagaaaaa	5172371	T

Q	222	tagagtgactgtaaaaaatgtctcttgttgccttc	256	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	5172372	tagagtgactgtaaaaaatgtctcttgttgccttc	5172406	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2

Raw Score: 37; E-Value: 0.000000000006

Query Start/End: Original strand, 18 - 96

Target Start/End: Original strand, 5172195 - 5172272

Alignment:

Q	18	aatgccatgtttgaatatctctattatttnnnnnnngaaagaaggatggcagtttctctcacacataagttaattgcaa	96	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|
T	5172195	aatgccatgtttgaatatttctattatttaaaaaa-gaaagcaggatggcagtttctctcacacttgagttaattgcaa	5172272	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]