View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_high_32 (Length: 249)
Name: NF8091_high_32
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 18873998 - 18874098
Alignment:
| Q |
1 |
gccttagatggccgtaatgtatcttctatttatgtcttgtttattagatacactccacgcatcccttgttcaattattaatttccagcagctagcacatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18873998 |
gccttagatggccgtaatgtatcttctatttatgtcttgtttattagatacactccacgcatcccttgttcaattattaattttcagcagctagcacatg |
18874097 |
T |
 |
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
18874098 |
c |
18874098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 169 - 245
Target Start/End: Original strand, 18874166 - 18874242
Alignment:
| Q |
169 |
gacagagaagttaggcttgcgaaaatggattagctgatttgtcaacaccgacaaagtacggaagaagaataatgtag |
245 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18874166 |
gacagagaagttaggcttgcaaaaatggattagttgatttgtcaacaccgacaaagtacggaagaagaataatgtag |
18874242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University