View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_high_33 (Length: 248)
Name: NF8091_high_33
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 209
Target Start/End: Complemental strand, 2137920 - 2137732
Alignment:
| Q |
21 |
actgaaacagtggcaaaaaaccacttagaagtcctagctgagatagatcgacttacgaaggcctttgagacacttcagcaagggaacacgccgtttcaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137920 |
actgaaacagtggcaaaaaaccacttagaagtcctagccgagatagatcgacttacgaaggcctttgagacacttcagcaagggaacacgccgtttcaag |
2137821 |
T |
 |
| Q |
121 |
agtcatccgatgctactgtgatcaactcaaccaaacagtcggtgagatatgttaaactttatgatttctaaaatgttatgaatttgatt |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2137820 |
agtcatcccatgctactgtgatcaactcaaccaaacagtcggtgagatatgttaaacttgatgatttctaaaattttatgaatttgatt |
2137732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 212 - 248
Target Start/End: Complemental strand, 2137701 - 2137665
Alignment:
| Q |
212 |
attgaatttataagacatattacagttcaaaatataa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137701 |
attgaatttataagacatattacagttcaaaatataa |
2137665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University