View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_high_37 (Length: 240)
Name: NF8091_high_37
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 5 - 104
Target Start/End: Complemental strand, 10999486 - 10999387
Alignment:
| Q |
5 |
accaaattaatttggccgaatccgtttcaagaggataaccctcaatttcaaatttgagatctagtagtattaataggatagttggtcttaattgtgtgtc |
104 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10999486 |
accaagttagtttggccgaatccgtttcaagaggataacccttaatttcaaatttgggatctagtagtattaattggatagttggtctaaattgtgtgtc |
10999387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 11000229 - 11000306
Alignment:
| Q |
8 |
aaattaatttggccgaatccgtttcaagaggataaccctcaatttcaaatttgag-atctagtagtattaataggata |
84 |
Q |
| |
|
||||||| || ||| |||| |||||||||||||||| ||||||| ||| || || |||||||||||||||| ||||| |
|
|
| T |
11000229 |
aaattaaattagccaaatcgatttcaagaggataaccgtcaattttaaaatttagaatctagtagtattaatgggata |
11000306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University