View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_high_39 (Length: 239)
Name: NF8091_high_39
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5509390 - 5509168
Alignment:
| Q |
1 |
atgtcttgttctaaaccccatcttttaagggaatgatagagatttttcaaagaagacagaacaacattaaggttgttttggtcttgttggcagaaagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509390 |
atgtcttgttctaaaccccatcttttaagggaatgatagagatttttcaaagaagacagaacaacattaaggttgttttggtcttgttggcagaaagttg |
5509291 |
T |
 |
| Q |
101 |
aggttttcccaacaatgttggtgatttttgatgaagggtaatatgggaaaatgtttaacctaagccaagtttcagctgataaaatgttgctagagaccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509290 |
aggttttcccaacaatgttggtgatttttgatgaagggtaatatgggaaaatgtttaacctaagccaagtttcagctgataaaatgttgctagagaccat |
5509191 |
T |
 |
| Q |
201 |
gttaaggtcttcattgttcaaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5509190 |
gttaaggtcttcattgttcaaag |
5509168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 20444896 - 20444686
Alignment:
| Q |
1 |
atgtcttgttctaaaccccatcttttaagggaatgatagagatttttcaaagaagacagaacaacattaa---------ggtt---gttttggtcttgtt |
88 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
20444896 |
atgtcttgttctaaaccccatcttttgagggaatgatagagatttttcaaagaagacagaacaacattaaatttgttttggttttggttttggtcttgtt |
20444797 |
T |
 |
| Q |
89 |
ggcagaaagttgaggttttcccaacaatgttggtgatttttgatgaagggtaatatgggaaaatgtttaacctaagccaagtttcagctgataaaatgtt |
188 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20444796 |
ggcagaaagttgaggtttttccaacaatcttggtttttttt-----------ttatgagaaaatgtttaacctaagccaagtttcagctgataaaatgtt |
20444708 |
T |
 |
| Q |
189 |
gctagagaccatgttaaggtct |
210 |
Q |
| |
|
|||||||||| ||||| ||||| |
|
|
| T |
20444707 |
gctagagaccttgttacggtct |
20444686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 20432691 - 20432616
Alignment:
| Q |
4 |
tcttgttctaaaccccatcttttaagggaatgatagagatttttcaaagaagacagaacaacattaaggttgtttt |
79 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20432691 |
tcttgttctaaaccccatcttttgagggaatgatagagatttttcaaagaagacagaacaacattaaggttgtttt |
20432616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University